Journal: Cell Reports

Article Title: Heart Regeneration in the Mexican Cavefish

doi: 10.1016/j.celrep.2018.10.072

Figure Lengend Snippet:

Article Snippet: Monoclonal mouse against Myosin Heavy Chain (MF20) , Developmental Studies Hybridoma Bank , Cat# MF 20; RRID: AB_2147781.

Techniques: Recombinant, Saline, Blocking Assay, Control, SYBR Green Assay, RNAscope, Multiplex Assay, Purification, RNA Sequencing, Sequencing, Software, Expressing

Journal: Cancer cell

Article Title: Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling

doi: 10.1016/j.ccell.2018.05.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ™ ) ImmPRESS ™ HRP (Peroxidase) Polymer Kit Vector Laboratories Cat# MP-2400 ImmPACT DAB Peroxidase (HRP) Substrate Vector Laboratories Cat# SK-4105 NE-PER ™ Nuclear and Cytoplasmic Extraction Reagents Thermo Scientific Cat# 78833 DIG RNA Labeling Kit Roche Cat# 11175025910 In Situ Hybridization m Mdm2 probe ACDbio/Biotechne Cat# 447641 RNAscope 2.5 HD Assay kit- BROWN ACDbio/Biotechne Cat# 322310 Super Script VILO cDNA synthesis kit Thermo Scientific Cat# 11754050 RNeasy Mini Kit Qiagen Cat# 74104 SsoAdvance SYBR Green Supermix Biorad Cat# 1725275 BCIP/NBT Color Development Substrate Promega Cat# S3771 Experimental Models: Cell Lines Dih10 The Karin Laboratory ( He et al., 2013 ) N/A DihXY The Karin Laboratory ( He et al., 2010 ; Shalapour et al., 2017 ) N/A Experimental Models: Organisms/Strains Mouse: C57BL/6 Charles River Laboratories Strain Code: 027 Mouse: Cd44 −/− The Jackson Laboratory Stock# 005085 Mouse: p53 F/F Anton Berns ( Budanov and Karin, 2008 ) (Jonkers et al., 2001) N/A Mouse: p21 −/− The Jackson Laboratory Stock# 016565 Mouse: Cd44 F/F This paper, Peter Herrlich (FLI, Germany) N/A Mouse: Albumin-Cre The Jackson Laboratory Stock# 003574 Mouse: EGFR F/F Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: Mx1Cre Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: MUP-uPA Eric P. Sandgren ( Weglarz et al., 2000 ) N/A Mouse: Tak1 ΔHep Ekihiro Seki ( Inokuchi et al., 2010 ) N/A Oligonucleotides ChIP Primer, m Cd44 promoter, forward: ATGGGCTGGATTTCCACATA This paper N/A ChIP Primer, m Cd44 promoter, reverse: CCTTTCTCCTCCCAGTCTCC This paper N/A ChIP negative control Primer, m Cd44 promoter, forward: GACTTCTCCCCCTTTTCTGC This paper N/A ChIP negative control Primer, m Cd44 promoter, reverse: GCACCTAACCTTCCCTGGTT This paper N/A ChIP Primer, m c-Fos promoter, forward: TCTGCCTTTCCCGCCTCCCC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m c-Fos promoter, reverse: GGCCGTGGAAACCTGCTGAC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m Gapdh promoter, forward: TTGAGCTAGGACTGGATAAGCAGGG This paper N/A ChIP Primer, m Gapdh promoter, reverse: GTCCGTATTTATAGGAACCCGGATGGTG This paper N/A Primers for analysis of gene-expression changes, see Table S2 The Karin Laboratory N/A Recombinant DNA mCD44 cDNA Open biosystems/Dharmacon Clone ID# 4910789 Cat # MMM1013-202766790 Software and Algorithms GraphPad Prism 7.0 software GraphPad Software, Inc. www.graphpad.com/scientific-software/prism/ R software version 3.3.2 R Foundation for Statistical Computing, Vienna, Austria http://www.r-project.org Image Studio Lite Software LI-COR www.licor.com Adobe Illustrator CS6 Adobe www.adobe.com Open in a separate window KEY RESOURCES TABLE Quantitative Real-Time PCR Analysis RNA samples were prepared using RNeasy kit (Qiagen# 74104).

Techniques: Recombinant, Blocking Assay, In Situ, TUNEL Assay, Plasmid Preparation, Amplification, Staining, Labeling, In Situ Hybridization, RNAscope 2.5 HD Assay, SYBR Green Assay, Negative Control, Software

Journal: Neuron

Article Title: Multimodal Single-Cell Analysis Reveals Physiological Maturation in the Developing Human Neocortex

doi: 10.1016/j.neuron.2019.01.027

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Biocytin was detected by Streptavidin Dylight 549 (1:500, Vector Labs SA-5549).

Techniques: Plasmid Preparation, RNAscope 2.5 HD Assay, RNA Sequencing Assay, Software

Journal: Immunity

Article Title: Single cell RNA sequencing of microglia throughout the mouse lifespan and in the injured brain reveals complex cell-state changes

doi: 10.1016/j.immuni.2018.11.004

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: anti-Tmem119 (for mouse staining, Abcam ab209064, 1:500), anti-Tmem119 (for human staining, Sigma, HPA051870 , 1:500), anti-CCL4/MIP-1 beta (for mouse staining, R&D Systems AF-451 1:25), anti-CCL4/MIP-1 beta (for human staining, R&D Systems AF-271, 1:25), anti-HLA-DR (LN3) (Abcam).

Techniques: Staining, Virus, Control, Recombinant, Multiplex Assay, RNAscope, Expressing, Software, Plasmid Preparation

Journal: Cell stem cell

Article Title: Lineage Tracing Reveals a Subset of Reserve Muscle Stem Cells Capable of Clonal Expansion under Stress

doi: 10.1016/j.stem.2019.03.020

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CometAssay® Kit (25 × 2 well slides) , Trevigen , Cat# 4250–050-K.

Techniques: Recombinant, RNAscope, Multiplex Assay, TUNEL Assay, Software

Journal: Developmental cell

Article Title: Myocardial polyploidization creates a barrier to heart regeneration in zebrafish

doi: 10.1016/j.devcel.2018.01.021

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Quantitative real-time PCR RNA from cardiac ventricles or zebrafish larvae was extracted using Trizol reagent (Life Technologies) and the Direct-zol RNA MicroPrep kit (Zymo Research).

Techniques: Recombinant, RNAscope 2.5 HD Assay, TUNEL Assay, In Situ, Clone Assay, Software, Fluorsave, Plasmid Preparation

Journal: Poultry Science

Article Title: Effects of high incubation temperature on tight junction proteins in the yolk sac and small intestine of embryonic broilers

doi: 10.1016/j.psj.2023.102875

Figure Lengend Snippet: In situ hybridization for JAMA and JAM2 mRNA in the jejunum and yolk sac tissue of day of hatch chicks. Eggs were incubated at 37.5°C (Experiment 1). Sections of the jejunum and yolk sac tissue from chicks at day of hatch were fixed in formaldehyde and embedded in paraffin. In situ hybridization was performed using probes for chicken JAMA and JAM2 and the RNAscope 2.5 HD Assay-RED. JAMA and JAM2 mRNA were revealed as red fluorescence. Sections were counterstained with hematoxylin. Fluorescent images were captured at 100× with a Nikon Eclipse 80i microscope and a Nikon DS-Ri2 camera. Scale bar equals 100 μm.

Article Snippet: Images were captured using fluorescence with a Nikon Eclipse 80i microscope and Nikon DS-Ri1 or DS-Ri2 cameras.

Techniques: In Situ Hybridization, Incubation, RNAscope 2.5 HD Assay, Fluorescence, Microscopy

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a , b Representative images of immunostaining ( a , n = 3 samples per indicated lesion) and RNAscope ( b , n = 3 samples per indicated lesion) of THBS1 in human CRCs and liver metastasis. The experiments were independently repeated three times, yielding similar results. c, THBS1 expression in tumor epithelium ( n = 13), and tumor stroma ( n = 13) of CRC dataset (GSE35602). d THBS1 expression in each subtype of CMS (top) and IMF (bottom) in TCGA. e Gene set enrichment analysis (GSEA) of the indicated gene sets. f Kaplan-Meier curve in CRC dataset (GSE14333). g – j Staining g in TMAs of human CRCs (THBS1: low n = 102, intermediate n = 122, high n = 107; the rest: low n = 46, intermediate n = 64, high n = 54). Proportion h of CMS4 subtype in indicated groups. Proportion i of CRCs with low-, intermediate- or high-intensity of THBS1 in CMS4-annotated CRCs. Quantification j of CD14 staining in g . k , l Proportion of stage 2 or 3 k and lymph node metastasis l in CRCs with low-, intermediate-, or high-intensity of THBS1 in TMAs. m , n Kaplan-Meier curves of patients corresponding to TMAs. Hazard ratio with 95% confidence interval and P values, analyzed by Log-rank test, are shown in f , m , n . Mean ± SEM. Scale bars, 50 μm a , b , top panels 200 μm and bottom panels 50 μm in each indicated protein g . P values were calculated by two tailed Mann-Whitney test in c , d or two-tailed, unpaired Student’s t test in j . Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Immunostaining, RNAscope, Expressing, Staining, Two Tailed Test, MANN-WHITNEY

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a Schematic representation of orthotopic MTO implantation. b Staining in orthotopic MTO tumors ( n = 5 mice). Bars, 500 μm (H&E), 50 μm (the rest). Dash lines denote necrotic areas. c GSEA of transcriptomics of orthotopic MTO tumors in WT or Thbs1 -/- mice ( n = 3). d Immunostaining in orthotopic MTO tumors ( n = 5 mice per group). Bars, 50 μm. e , Proportion of indicated cells in total cells of orthotopic MTO tumors, analyzed by FACS ( n = 3 tumors from three distinct mice per group). f Immunostaining in orthotopic MTO tumors ( n = 5 mice per group). Bars, 50 μm. g – k scRNA-seq of orthotopic MTO tumors ( n = 2 tumors from two distinct mice per group; analyzed cell numbers are indicated in Methods “Single-cell RNA sequencing”). UMAP plot g and proportion of each compartment h in re-clustered CD8 + T subset. Violin plots ( i , j ) and dot plots of representative genes k for the indicated gene signatures in each CD8 subset. l Expression levels of TCF7 in TCGA ( n = 296 samples per group). m Schematic representation of stimulation experiment of isolated CD3 + T cells. n , o FACS analyses of proportion of indicated marker-expressing cells in CD8 + T cells in m ( n = 3 biologically independent samples). p Co-immunostaining for CD8 and TCF7 (left) or CTLA4 (right) in primary tumors of MTO-inoculated mouse and proportion of double positively stained cells per field ( n = 3 mice per group). White arrowheads denote double positive cells. Scale bars, 50 μm. q Cytotoxicity assay by co-culture of OVA-expressing MTO and OVA53 cells in the presence or absence of THBS1 ( n = 3 biologically independent samples per group). Vertical axis indicates the proportion of dead cells (7-AAD + ) in CFSE labeled OVA-expressing MTO. Staining experiments b , d , f were independently repeated three times. Mean ± SEM. Two-tailed, unpaired Student’s t test in e , n , o – q , two-tailed Mann–Whitney test in i , j , l . Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Staining, Immunostaining, RNA Sequencing, Expressing, Isolation, Marker, Cytotoxicity Assay, Co-Culture Assay, Labeling, Two Tailed Test, MANN-WHITNEY

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a – d Orthotopic implantation of MTO. Bioluminescence imaging ( a ; white arrows: primary lesions, yellow arrows: distant metastases), H&E of liver ( b left), CK19 staining of lymph node ( b , right), macroscopic numbers of liver or lymph node metastasis ( c ; n : WT = 14, Thbs1 -/- = 12), and Kaplan-Meier curve d . Hazard ratio with 95% confidence interval and P values, by Log-rank test. e – h Anti-CD8 antibody (αCD8 ab) treatment on MTO-inoculated Thbs1 -/- mice ( n : control = 12, αCD8 ab = 11). Schematic representation e , immunostaining and quantification in primary tumors in e ( f , n = 5 mice per group), H&E of liver g , and macroscopic numbers of metastasis h . i–k αCD8 ab treatment on MTO splenic injection model ( n : control = 5, Thbs1 -/- = 7, Thbs1 -/- + αCD8 ab = 7). Schematic representation i , bioluminescence imaging ( j , top), H&E of liver ( j , bottom), and macroscopic numbers of metastasis k . l FACS analyses of THBS1 + cell proportion per total cells in indicated lesions in MTO-bearing WT mice ( n = 3 mice per group). m Immunostaining in indicated lesions. n – p FACS analyses on proportion of indicated cells among total cells in primary tumors or liver metastasis ( n = 3 mice per group) in MTO-bearing WT mice. Dendritic cells, CD45 + CD11c + ; TAM, CD11b + F4/80 + ; neutrophils, CD45 + CD11c - CD11b + Ly6C + Ly6G + F4/80 - ; monocytes, CD45 + CD11c - CD11b + Ly6C + Ly6G - F4/80 - ; PMN-MDSC, CD45 + CD11c - CD11b + Ly6C + Ly6G + ; MO-MDSC, CD45 + CD11c - CD11b + Ly6C + Ly6G - cells. q Co-immunostaining in indicated lesions. PMN-MDSC, Ly6C + Ly6G + ; MO-MDSC, Ly6C + Ly6G - cells ( n = 3 mice). r MDSC assay by co-culturing T cells isolated from WT mice and MO-MDSCs or PMN-MDSCs from primary tumors in MTO-bearing WT or Thbs1 -/- mice, measured by FACS are shown ( n = 3 biologically independent samples). s Co-immunostaining in indicated lesions ( n = 3 mice). White arrowheads denote co-stained cells. Mean ± SEM. P values were calculated by two-tailed, unpaired Student’s t test (except d ). Scale bars, 500 μm ( b , left; g ), 200 μm ( b ,right; j ). 50 μm f , m , q , 25 μm s . Dash lines denote liver metastases b , g , j . Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Imaging, Staining, Control, Immunostaining, Injection, Isolation, Two Tailed Test

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a Schematic representation of orthotopic implantation of MTO in the mice with indicated genotypes ( n : WT = 14, Thbs1 -/- = 11, CD36 -/- = 12, CD47 -/- = 12). b – d Immunostaining b and quantification of b ( c ; n = 5 mice per group) of the primary tumors and H&E staining d of liver of a . Dash lines denote liver metastases. e Macroscopic quantification of the numbers of liver and lymph node metastases in a ( n = mice, per genotype: WT = 14, Thbs1 -/- = 11, CD36 -/- = 12, CD47 -/- = 12). f qRT-PCR analysis in the orthotopic MTO tumors in WT and Cd36 -/- mice ( n = 3 mice per group). g Co-immunostaining for CD8 and CD47 (top) or CD36 (bottom) in primary lesions of MTO-bearing WT mice ( n = 3 mice). White arrowheads denote co-stained cells. h , i FACS analyses of indicated cell proportions in CD8 + (CD3 + CD8 + ) T cells sorted from CD47 -/- h or CD36 -/- i mice. Individual plots indicate the biological replicates of isolated CD8 + (CD3 + CD8 + ) CD47 -/- T cells or CD36 -/- T cells ( n = 3 per group) treated with or without anti-CD3/CD28 antibodies. j Representative images of tube formation assay of C166 cells in the presence or absence of recombinant THBS1 (25 μg/ml) or presence of THBS1 combined with anti-CD47 antibody (αCD47ab) or sulfosuccinimidyl oleate (SSO) at indicated concentration, and quantification of tube area ( n = 3 biologically independent samples). Scale bars, 50 μm b , g , 100 μm j , 200 μm d . Mean ± SEM. P values were calculated by two-tailed, unpaired Student’s t test. Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Immunostaining, Staining, Quantitative RT-PCR, Isolation, Tube Formation Assay, Recombinant, Concentration Assay, Two Tailed Test

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a Co-immunostaining of the orthotopic MTO tumors in WT mice ( n = 3 mice). b Schematic representation of orthotopic implantation of MTO to the mice with indicated genotypes. c Co-immunostaining in the MTO tumors in LysM;EYFP mice ( n = 3 mice). d qRT-PCR analysis in the orthotopic MTO tumors in LysM;EYFP ( n = 5 mice) and LysM;Thbs1 Δ/Δ mice ( n = 4 mice). e Bioluminescence imaging (top) and H&E of liver (bottom) of b . f Macroscopic numbers of metastases in liver ( n = mice per group: LysM;EYF P = 12, LysM;Thbs1 Δ/Δ = 7) and lymph node ( n = mice per group: LysM;EYFP = 13, LysM;Thbs1 Δ/Δ = 10) of b . g Immunostaining in the orthotopic MTO tumors of b ( n = 5 mice). h – j UMAP plot h of murine myeloid clusters, and UMAP plots i and heatmap j of representative genes for each cluster of ( h ) in scRNAseq data of orthotopic MTO tumors (GSE154863). Dash lines denote monocyte-like cluster. k – m UMAP plot k of human myeloid clusters and UMAP plots l and dot plots m of representative genes for each cluster of k in SMC dataset (GSE132465). Dash lines denote monocyte-like cluster. n Transcript levels of indicated genes in TCGA ( n = 296). o Proportions of monocyte-like cells in myeloid cellular compartment of SMC, stratified by CMS subtypes. p Violin plots for indicated genes in TCGA, stratified by CMS subtypes (n: CMS1 = 85, CNS2 = 132, CMS3 = 78, CMS4 = 184). q Co-immunostaining in human CRC (n = 3 samples). Arrows in e : primary lesion (white), distant metastases (yellow). Dash lines denote liver metastases in e . Scale bars, 10 μm ( a , c , g , q ), 500 μm e . Immunostaining experiments ( a , c , g , q ) were independently repeated at least three times, yielding similar results. P values were calculated by two-tailed, unpaired Student’s t test in d , f , or two-tailed Mann–Whitney test n , p . Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Immunostaining, Quantitative RT-PCR, Imaging, Two Tailed Test, MANN-WHITNEY

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a qRT-PCR analyses in BM cells ( n = 3 mice). b FACS analyses in the BM and peripheral blood cells ( n = 3 mice). Positive cell numbers in 10000 total cells are shown. c qRT-PCR analyses of sorted cells from BM or peripheral blood of MTO-bearing mice ( n = 3 mice). d , e qRT-PCR analyses of sorted cells from MTO tumors in GFP-BM mice ( n = 3 mice). f Co-immunostaining of the MTO tumors in GFP-BM mice ( n = 3 mice). g qRT-PCR analyses of the MTO tumors in WT-BM WT ( n = 5), Thbs1 -/- -BM Thbs1 -/- ( n = 6), and WT-BM Thbs1 -/- chimeric mice ( n = 5). h Macroscopic numbers of metastasis (n: WT-BM WT = 13, Thbs1 -/- -BM Thbs1 -/- = 5, WT-BM Thbs1 -/- chimeric mice = 15). i Bioluminescence imaging (top) and H&E staining of liver (bottom) in indicated mice with MTO implantation. j Immunostaining in MTO tumors and positive cell proportion ( n = 5 mice). k qRT-PCR analyses in BM cells of MC38- or MTO-bearing mice ( n = 3 mice). l Heatmap in TCGA (n: CMS1 = 85, CNS2 = 132, CMS3 = 78, CMS4 = 184). m qRT-PCR analyses in indicated orthotopic tumors in WT mice ( n = 3 mice). n Transcript levels in TCGA. o , qRT-PCR analyses of sorted cells from BM of MTO-bearing mice ( n = 3). p , FACS analyses of proportions among THBS1 + cells in MTO-bearing WT mice ( n = 3). q , Co-immunostaining in WT tumors ( n = 3 mice). r – u CXCL12 inhibitor (LIT-927) treatment, following orthotopic MTO implantation (n: control = 8, LIT-927 = 7). Schematic representation ( r ), qRT-PCR analyses ( s , n = 4), bioluminescence imaging t , and quantification of macroscopic numbers of metastases u . Arrows in i , t : primary lesions (white), distant metastases (yellow). Dash lines denote liver metastases in i . Scale bars, 10 μm f , j , q , 500 μm i . Mean ± SEM. Two tailed, Mann–Whitney test n , one-way ANOVA p , or tow tailed, unpaired Student’s t test (the rest). Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Quantitative RT-PCR, Immunostaining, Imaging, Staining, Control, Two Tailed Test, MANN-WHITNEY

Journal: Nature Communications

Article Title: THBS1-producing tumor-infiltrating monocyte-like cells contribute to immunosuppression and metastasis in colorectal cancer

doi: 10.1038/s41467-023-41095-y

Figure Lengend Snippet: a THBS1 expression in MSI-H or MSS CRC from TCGA. b Proportion of MSI-H CRC in TMA samples, stratified by THBS1 expression intensity ( n : high = 100, intermediate = 115, low = 93). c – h Treatment experiment with anti-PD-1 antibody (αPD-1 ab) or anti-VEGFR2 antibody (αVEGFR2 ab) on MTO-bearing WT or Thbs1 -/- mice (n: WT control = 8, THBS1 -/- control = 7, WT with αPD-1 ab = 9, Thbs1 -/- with αPD-1 ab = 8, WT with αVEGFR2 ab = 8, Thbs1 -/- with αVEGFR2 ab = 6). Schematic representation c , and bioluminescence imaging d . Macroscopic images e , growth kinetics f , and the change in diameter g of primary tumors in indicated groups. Macroscopic numbers of liver and lymph node metastases h . i , j Tomato lectin staining ( i ) in the orthotopic MTO tumors in WT ( n = 5) or Thbs1 -/- mice ( n = 4) and quantification j . k–p , Treatment experiment with FOLFOX on MTO-bearing WT or Thbs1 -/- mice ( n = mice per group: WT control = 6, THBS1 -/- control = 5, WT with FOLFOX = 15, Thbs1 -/- with FOLFOX = 9). Schematic representation k and bioluminescence imaging l . Macroscopic images m , growth kinetics n , and the change in diameter o of primary tumors in indicated groups. Macroscopic numbers of liver and lymph node metastases p . Arrows in d , l : primary lesions (white), distant metastases (yellow). Scale bars: 50 μm in i , 1 cm (rest). Mean ± SEM. The whiskers show smallest and largest values and the box extends from the 25th to 75th percentiles, and the line of the middle of the box is plotted at the median in Box and whiskers plot g , o . P values are calculated by two tailed, unpaired Student’s t test g , h , j , o , p , two tailed, Mann–Whitney test a , or two-way ANOVA f , n . Source data are provided as a Source Data file.

Article Snippet: 50 μl of ECM gel was added to each well of 96 well plate and incubated for 30 min. 5 × 10 4 cells of Mouse endothelial cells, C166 were harvested in each well in the presence or absence of recombinant THBS1 (25 μg/ml; 7859-TH-050, R&D systems), simultaneously treated with anti CD47 antibody (10 μg/ml; BE0270, BioXcell) or sulfosuccinimidyl oleate (SSO) (20 μM, 25 μM, 50 μM, 100 μM, 200 μM; 11211, Cayman Chemical).

Techniques: Expressing, Control, Imaging, Staining, Two Tailed Test, MANN-WHITNEY

Journal: Cancer cell

Article Title: Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling

doi: 10.1016/j.ccell.2018.05.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Chromatin diluted with 9 volumes of dilution buffer (0.01% SDS, 1.2 mM EDTA, 16.7 mM Tris HCl pH 8, 1.1% Triton X-100, 167 mM NaCl, protease inhibitors) was incubated overnight with 20μl of Protein A dynabeads (Invitrogen# 10001D) coated with rabbit anti-STAT3 (2 μg), (Santa Cruz# sc-482), or rabbit IgG (Santa Cruz# sc-2027) as control as described ( Dahl and Collas, 2007 ).

Techniques: Recombinant, Blocking Assay, In Situ, TUNEL Assay, Plasmid Preparation, Amplification, Staining, Labeling, In Situ Hybridization, RNAscope 2.5 HD Assay, SYBR Green Assay, Negative Control, Software

Journal: Cancer cell

Article Title: Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling

doi: 10.1016/j.ccell.2018.05.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ™ ) ImmPRESS ™ HRP (Peroxidase) Polymer Kit Vector Laboratories Cat# MP-2400 ImmPACT DAB Peroxidase (HRP) Substrate Vector Laboratories Cat# SK-4105 NE-PER ™ Nuclear and Cytoplasmic Extraction Reagents Thermo Scientific Cat# 78833 DIG RNA Labeling Kit Roche Cat# 11175025910 In Situ Hybridization m Mdm2 probe ACDbio/Biotechne Cat# 447641 RNAscope 2.5 HD Assay kit- BROWN ACDbio/Biotechne Cat# 322310 Super Script VILO cDNA synthesis kit Thermo Scientific Cat# 11754050 RNeasy Mini Kit Qiagen Cat# 74104 SsoAdvance SYBR Green Supermix Biorad Cat# 1725275 BCIP/NBT Color Development Substrate Promega Cat# S3771 Experimental Models: Cell Lines Dih10 The Karin Laboratory ( He et al., 2013 ) N/A DihXY The Karin Laboratory ( He et al., 2010 ; Shalapour et al., 2017 ) N/A Experimental Models: Organisms/Strains Mouse: C57BL/6 Charles River Laboratories Strain Code: 027 Mouse: Cd44 −/− The Jackson Laboratory Stock# 005085 Mouse: p53 F/F Anton Berns ( Budanov and Karin, 2008 ) (Jonkers et al., 2001) N/A Mouse: p21 −/− The Jackson Laboratory Stock# 016565 Mouse: Cd44 F/F This paper, Peter Herrlich (FLI, Germany) N/A Mouse: Albumin-Cre The Jackson Laboratory Stock# 003574 Mouse: EGFR F/F Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: Mx1Cre Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: MUP-uPA Eric P. Sandgren ( Weglarz et al., 2000 ) N/A Mouse: Tak1 ΔHep Ekihiro Seki ( Inokuchi et al., 2010 ) N/A Oligonucleotides ChIP Primer, m Cd44 promoter, forward: ATGGGCTGGATTTCCACATA This paper N/A ChIP Primer, m Cd44 promoter, reverse: CCTTTCTCCTCCCAGTCTCC This paper N/A ChIP negative control Primer, m Cd44 promoter, forward: GACTTCTCCCCCTTTTCTGC This paper N/A ChIP negative control Primer, m Cd44 promoter, reverse: GCACCTAACCTTCCCTGGTT This paper N/A ChIP Primer, m c-Fos promoter, forward: TCTGCCTTTCCCGCCTCCCC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m c-Fos promoter, reverse: GGCCGTGGAAACCTGCTGAC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m Gapdh promoter, forward: TTGAGCTAGGACTGGATAAGCAGGG This paper N/A ChIP Primer, m Gapdh promoter, reverse: GTCCGTATTTATAGGAACCCGGATGGTG This paper N/A Primers for analysis of gene-expression changes, see Table S2 The Karin Laboratory N/A Recombinant DNA mCD44 cDNA Open biosystems/Dharmacon Clone ID# 4910789 Cat # MMM1013-202766790 Software and Algorithms GraphPad Prism 7.0 software GraphPad Software, Inc. www.graphpad.com/scientific-software/prism/ R software version 3.3.2 R Foundation for Statistical Computing, Vienna, Austria http://www.r-project.org Image Studio Lite Software LI-COR www.licor.com Adobe Illustrator CS6 Adobe www.adobe.com Open in a separate window KEY RESOURCES TABLE Quantitative Real-Time PCR Analysis RNA samples were prepared using RNeasy kit (Qiagen# 74104).

Techniques: Recombinant, Blocking Assay, In Situ, TUNEL Assay, Plasmid Preparation, Amplification, Staining, Labeling, In Situ Hybridization, RNAscope 2.5 HD Assay, SYBR Green Assay, Negative Control, Software